De Bruijn Graph - Build an OLC Graph - Python Script called hamiltonianDBG.py - Computer Science Assessment Answer

Computer Science Assessment Answer

1. Write a Python script called eulerianDBG.py that will
   1. Use the networkx package and build the De Bruijn graph of the given sequence below. Use a kmer length of 4 (+10pts)
      1. Sequence (same as Part I #1): ATGTCTAGTGAACGTAGGCCTGA
   2. Find all Eulerian paths (i.e. visit every edge, can visit a node more than once) AND output the sequences for all Eulerian paths (+15pts)
   3. Each of the above MUST be separate functions (+5pts)
2. Write a Python script called hamiltonianDBG.py and

1. 1. Use the networkx package and build an OLC graph for the reads below. Use your alignNW.py function from Assignment 3 to calculate the alignment score for all combinations of pairs of reads and assign this score to your edges. (+15pts) (If you were not able to complete alignNW.py OR did not do it correctly, feel free to use the function located in
   2. Write a function that will take the Hamilton path following the best edge score of your OLC graph (i.e. visit every node only once) AND output the sequence by walking this path. You will need to keep your alignments to know where the overlaps occurred for each node (hint: a dictionary of your alignments could be useful). (+15pts)

This Computer Science Assessment has been solved by our Computer Science experts at My Uni Paper. Our Assignment Writing Experts are efficient to provide a fresh solution to this question. We are serving more than 10000+ Students in Australia, UK & US by helping them to score HD in their academics. Our Experts are well trained to follow all marking rubrics & referencing style.